🏆
International Engineering Publisher
Serving Researchers Since 2012

Rapid Identification of Human Pathogenic Vibrio Species in Fresh Water using Multiplex PCR

DOI : 10.17577/IJERTV4IS070139

Download Full-Text PDF Cite this Publication

  • Open Access
  • Total Downloads : 781
  • Authors : Amit Ranjan Prasad Singh, Manisha, Manvinder Singh
  • Paper ID : IJERTV4IS070139
  • Volume & Issue : Volume 04, Issue 07 (July 2015)
  • DOI : http://dx.doi.org/10.17577/IJERTV4IS070139
  • Published (First Online): 29-07-2015
  • ISSN (Online) : 2278-0181
  • Publisher Name : IJERT
  • License: Creative Commons License This work is licensed under a Creative Commons Attribution 4.0 International License

Text Only Version

Rapid Identification of Human Pathogenic Vibrio Species in Fresh Water using Multiplex PCR

Amit Ranjan Prasad Singh

Jacob school of Biotechnology and Bioengineering, SHIATS, Allahabad

Manisha, Manvinder Singh

2 Department of Biotechnology,

U. I. E. T Biotechnology Engineering and Technology of Maharishi Dayanand University, Rohtak

Abstract In the present investigation we focus on identification of Vibrio species in different rivers and ponds of Indian northern plains. This study targets five species of Vibrio such as Vibrio alginolyticus, Vibrio cholerae, Vibrio mimicus, Vibrio parahaemolyticus, Vibrio vulnificus which are the major human disease causing Vibrio species. Primarily identification of Vibrio species done through grams staining and further by color of colonies developed on TCBS agar plates. A multiplex PCR assay had been developed for the detection of targeted five species of Vibrio for the DNA isolated from various samples of water using specific primers targeting tox gene. The assay was specific as no amplification occurred for other bacterial DNA.

KeywordsMultiplex PCR, Vibrio sp.,amplification, TCBS,tox gene

I.INTRODUCTION

Water is a vital natural resource because of its basic role to life, quality of life, the environment, food production, hygiene, industry, and power generation (Meays et al., 2004). With the rapid increase in world population and increased urbanization, THERE IS A MASSIVE STRAIN ON THE EXISTING WATER SUPPLY

AND sanitation facilities (UNDPI, 2005). In the developing world, poor access to safe water and inadequate sanitation continues to be a danger to human health (World Health Organisation [WHO], 2004).India's 14 major, 55 minor and several hundred small rivers receive millions of litres of sewage, industrial and agricultural wastes. The most polluting source for rivers is the city sewage and industrial waste discharge. Presently, only about 10 per cent of the waste water generated is treated; the rest is discharged as it is into our water bodies. Due to this, pollutants enter rivers, lakes and groundwater (Ministry of Environment and Forests; 2011-12).

The paucity of clean water for domestic use has led to the increase in the number of deaths in both the urban and rural parts of developing economies. Deaths due to water related diseases in India are in the range of nearly 80%.Lack of water, sanitation, and hygiene results in the loss of 0.4 million lives while air pollution contributes to the death of 0.52 million people annually in India (WHO 2007). Environmental factors contribute to 60 years of ill-health per 1,000 population in India compared to 54 in Russia, 37 in Brazil, and 34 in China. The socio-economic costs of water pollution are extremely high: 1.5 million children less than 5 years die each year due to water related diseases; 200 million person days. Water related diseases plague many Indians. The availability of fresh and good quality drinking water to all Indians remains a concern.

Pathogenic microbes have been implicated in human diseases linked with the use of contaminated water and food. Adequate sanitation and clean water, being two critical factors in ensuring human health, protects against a wide range of water- related diseases. These include diarrhoea, cholera, trachoma, dysentery, typhoid, hepatitis, polio, malaria, and filariasis (United Nations Department of Public Information (UNDPI, 2005).

Vibrio-species is widely acknowledged as one of the most important waterborne pathogen causing gastrointestinal disorders. Cholera is one of the five most deadly water related diseases that occur in India .In India cholera related deaths are most common in places with shortage of good quality water. In 2010, nearly 140 people died of cholera in Odisha (formerly known as Orissa). Vibrio species bacteria are ubiquitous in aquatic environments including fresh, coastal and marine habitats. They are also found as commensals on the surfaces and in the digestive tracts of fish and in zooplanktons (Drake et al., 2007; Montanari et al., 1999). They are transmitted to humans via raw or improperly cooked fish or contaminated water.

The importance of Vibrio-spp.asa contaminant of raw or undercooked aqua-culture food has been well established (Gopal et al., 2005; Di Pinto et al., 2008; Luan et al., 2008) and may lead to acute gastroenteritis including diarrhea, headache, vomiting, nausea and fever (Apun et al., 1999; Vongxay et al., 2008; Yang et al., 2008). As food safety is a major global concern that affects the consumer and those in the food service sector (Badrie et al., 2006; Jacxsens et al., 2009), serious attention has to be given to the aquaculture industry as fish can act as a vector for human pathogenic bacteria. Therefore, it is important to have data on the prevalence of Vibrio spp. in freshwater. Freshwater fish are easily available in local market and these fishes are highly consumed by customers.

Multiplex PCR-based detection is a popular and effective method to distinguish closely related bacterial species such as Vibrio-species (Edwards & Gibbs 1994; Haldar et al., 2010). This is carried out either through the use of different gene- specific primers to detect various strains of a particular species of Vibrio (e.g. Rodkhum et al., 2006) or through the use of a single gene-specific primer set to differentiate Vibrios (e.g. Haldar et al., 2010).

  1. MATERIALS & METHODOLOGY

    1. Collection of Water Samples

      For the present study water samples were collected from different rivers and ponds of Indian northern plains where Vibrio related waterborne diseases are major concern. In this study pond water samples were collected from various regions of Bundelkhand where people highly rely on these sources as major water source. For each site five water samples were collected.

      TABLE I. LIST OF SAMPLES COLLECTED

      S.N.

      Sample Name

      Collection Place

      Type

      1.

      Bakshi ka Talab

      Lucknow

      Pound water

      2.

      MahirkaTalab

      Orai

      Pound water

      3.

      Ram kund

      Orai

      Pound water

      4.

      KeemathJheel

      Agara

      Pound water

      5.

      PalahariTalab

      Banda

      Pound water

      6.

      BadokharTalab

      Banda

      Pound water

      7.

      Fun Pound

      Lucknow

      Pound water

      8.

      Mama kaTalab

      Allahabad

      Pound water

      9.

      PragiTalab

      Banda

      Pound water

      10.

      Sarada River

      Lakhimpurkhiri

      River water

      11

      Ramganga River

      Barelli

      River water

      12

      Betawa River

      Hamirpur

      River water

      13.

      Cane River

      Hamirpur

      River water

      14

      Son River

      Sasaram

      River water

      15.

      Punpun River

      Aurangabad

      River water

      16

      Adari River

      Arangabad

      River water

      17

      Pandu River

      Panka Village

      River water

      18.

      Pandu River

      Kanpur city

      River water

      19.

      PankiNahar

      Kanpur

      River water

      20.

      Gomti River

      Chandrika , Lucknow

      River water

      21.

      Gomti River

      Hanumansetu , Lucknow

      River water

      22.

      Gomti River

      Laxaman Park , Lucknow

      River water

      23

      Gomti River

      Jaunpur

      River water

      23

      Tonse River

      Azamgarh

      River water

      22.

      Tonse River

      Allahabad

      River water

      23

      Yamuna River

      New Delhi

      River water

      24.

      Yamuna River

      Agara

      River water

      25.

      Yamuna River

      Hamirpur

      River water

      26.

      Yamuna River

      Kaushambi

      River water

      27.

      Yamuna River

      Gaughat , Allahabad

      River water

      28.

      Yamuna River

      Baluaghat , Allahabad

      River water

      29.

      Ganga River

      Kanpur

      River water

      30.

      Ganga River

      Kaushambi

      River water

      31.

      Ganga River

      Araighat , Allahabad

      River water

      32.

      Ganga River

      Ramghat , Allahabad

      River water

      33.

      Ganga River

      Haridawar

      River water

      34.

      Mandakani River

      Chitrakut

      River water

      35.

      Rapti River

      Gorakhpur

      River water

      37

      Ghaghara River

      Bashti

      River water

      38

      Ghaghara River

      Ambedkarnagar

      River water

    2. Analysis of water samples

      For each site

      Spreading had been done with 200µl of water sample on the TCBS media, and kept in incubation for 24 hrs at 37°C for colony growth. Streaking of yellow and green colonies obtained on TCBS media had been done separately on TSA (Trypto Soya Agar) Media for isolation of pure colonies. Bacterial DNA isolation was done with colonies obtained on TSA plates.

    3. Isolation of Bacterial Genomic DNA

      A chemical method was used for the isolation of bacterial DNA from TSA plates. Bacterial colonies were first dissolved in TE buffer. This mixture had been centrifuged at 10,000rpm for 10 minutes, supernatant was discarded and the pellet was dissolved in mixture of 467µl TE buffer, 30µl 10% SDS and 3

      µl Proteinase K. This mixture incubated for one hour at 45°C. After one hour equal volume of phenol: chloroform (1:1) is added to mixture. After 10 minutes of invert mix centrifuged at 10,000 rpm. Upper aqueous layer separated by denatured protein transferred in to new eppendrop and 1/10 volume of sodium acetate and remaining volume of ice chilled isopropanol added. This mixture is incubated at 0°C for overnight. After incubation the mixture is centrifuged at 10,000rpm thats formed a pellet that is DNA. This pellet is washed with 70% ethanol and after washing this pellet is stored in 50 to 100µl TE buffer. This isolated DNA is stored and further used as raw material for PCR amplification.

    4. Primer Designing

      In this identification method, five pairs of oligonucleotide primers were designed to simultaneously detect five different types of Vibrio species by m-PCR. They are targeted at a species-specific tox gene region of the Vibrio. Table 3 lists the primers used for the amplification of these genes and the predicted sizes of the amplification products. To facilitate PCR product detection, the primers were designed such that the predicted sizes of the amplification products of each target gene would be different to permit size discrimination by gel electrophoresis.

      TABLE II. OPTIMIZATION OF MULTIPLEX PCR

      Universal Forward

      VM-F

      CAGGTTTGYTGCACGGCGAAGA

      5 Reverse primer :

      V. cholera

      VC-Rmm

      AGCAGCTTATGACCAATAACGCC

      V. parahaemolyticus

      VP-MmR

      TGCGAAGAAAGGCTCATCAGAG

      V. vulnificus

      VV-Rmm

      GTACGAAATTCTGACCGATCAA

      V.mimicus

      VM-Rmm

      YCTTGAAGAAGCGGTTCGTGCA

      V.algicusinolyt

      V.a12MmR

      GATCGAAGTRCCRACACTMGGA

    5. OPTIMIZATION OF MULTIPLEX PCR

    Specific and sensitive amplification of target gene sequences by m-PCR are dependent on a number of key parameters like annealing temperature, primer concentration, Mg2+ concentration, extension time, and the amount and quality of Taq polymerase used (HenegariuO et al.,1997). A systematic study was, therefore, performed to optimize the m- PCR conditions to obtain similar and maximal band intensities for each of the gene amplicons.

    TABLE III. PCR COMPONENTS

    Chemical

    Stock

    Working

    PCR buffer

    10 x

    2µl (1 x)

    DNTP

    2.5 mM

    1.6 µl (0.2 mM/L)

    Primer

    100 ppm

    Universal forward primer

    1µl (8 ppm)

    Reverse primer Vibrio cholera

    1µl (8 ppm)

    Reverse primer Vibrio vulnificius

    1µl (8 ppm)

    Reverse primer Vibrio parahaemolyticus

    1µl (8 ppm)

    Reverse primer Vibrio mimicus

    1µl (8 ppm)

    Reverse primer Vibrio alginolyticus

    1µl (8 ppm)

    Taq Polymerase

    5 U

    0.2µl (5 Unit)

    Distilled Water

    10.2µl

    Total

    20µl

    TABLE IV.PCR CONDITIONS

    Initial Denaturation

    94°C for 3 min

    Denaturation

    94°C for 30 sec

    Annealing

    60°C for 30 sec

    Extension

    72°C for 60 sec

    Final extension

    72°C for 7 min

    Number of cycles

    35

    The amplification products were visualized after electrophoresis at 100 V for 45 mins on a 1% agrose gel by ethidium bromide staining.

  2. RESULT & DISCUSSION

    The isolated Vibrio species were primarily confirmed by Gram staining and colony morphology on TCBS agar. Gram negative, rods, characteristically curved or comma-shaped. After 18-24 hours incubation colonies on TCBS are at least 2 mm in diameter and yellow in the case of sucrose fermenters and green non-sucrose fermenters.

    TABLE V.COLONY COLOUR

    Organism

    Color of Colonies on TCBS

    V. alginolyticus

    Yellow

    V. cholera

    Yellow

    V. parehaemolyticus

    Green

    V. vulnificus

    Green

    V. mimicus

    Green

    Fig 1: Colony of Vibrio on TCBS media

    Water sample collected from Ganga river, Haridwar and from Mandakani river, chitrakut, Banda did not shown any colony growth on TCBS media. Water sample from Ramkund (Orai), Mahirkatalab (Orai), Tonse River (Allahabad), Ganga River (Arailghat, Allahabad), Yamuna River(New Delhi), Gomti

    River (Chandrika, Lucknow), Yamuna River (Gaughat, Allahabad), Kukrail River (Lucknow), Rapti River (Gorakhpur) shown maximum growth of yellow colonies. Water sample from Badokhar Talab (Banda), Bakshi ka Talab (Lucknow), Mama ka Talab (Allahabad), keemath Jheel (Agra), Pragi Talab (Banda), Ganga River( Kanpur), Yamuna River ( Kaushambi), Cane River(Banda), Ramganga, Barelli, Betwa River (Hamirpur), Sharda River( Lakhimpur khiri), Tonse River , Azamgarh, Ganga River (Kaushambi), Ganga River (Ramghat , Allahabad) shows maximum growth of green colonies.

    Fig 2: Electrophoretic analysis of isolated DNA on a 0.8% agarose gel

    0.8% Agarose Gel was prepared. Loading dye 3µl + DNA sample 5µl

    TABLE VI.0.8% AGAROSE GEL

    Lane 1

    DNA ladder

    Lane 2

    Sample 1

    Lane 3

    Sample 2

    Lane 4

    Sample 3

    Lane 5

    Sample 4

    Lane 6

    Sample 5

    Fig 3: Electrophoretic analysis of PCR amplified target Genes from different Vibrio species.

    1% Agarose Gel

    Loading Dye 3µl + Sample 5µl

    TABLE VII.1.2% AGAROSE GEL

    Lane 1

    DNA ladder

    Lane 2

    Vibrio vulnificus

    Lane 3

    Vibrio parehaemolyticus

    Lane 4

    Vibrio cholerae

    Lane 5

    Vibrio mimicus

    Lane 6

    Vibrio alginolyticus

    Samle Name

    Vp

    Vv

    Vm

    Vc

    Va

    Bakshi ka Talab, Lucknow (G)

    +

    +

    +

    _

    _

    Mahir Ka Talab, Orai(G)

    +

    _

    +

    _

    _

    Mahir Ka Talab, Orai(Y)

    _

    _

    _

    +

    +

    Palaharitalab,Banda(G)

    _

    _

    +

    _

    _

    Palaharitalab,Banda(Y)

    _

    _

    _

    +

    _

    Ram Kund, Orai(Y)

    _

    _

    _

    +

    +

    Pragi Talab,Banda(G)

    +

    _

    _

    _

    _

    Keemath Jheel, Agara(G)

    _

    +

    +

    _

    _

    Keemath Jheel, Agara(Y)

    _

    _

    _

    +

    +

    Mama Ka Talab, Allahabad(G)

    _

    +

    +

    _

    _

    Mama Ka Talab, Allahabad(Y)

    _

    _

    _

    +

    +

    Fun Pond, Lucknow(G)

    _

    +

    _

    _

    _

    Fun Pond, Lucknow (Y)

    _

    _

    _

    +

    _

    Sarada River, Lakhimpurkhiri(G)

    +

    +

    +

    _

    _

    Sarada River, Lakhimpurkhiri(Y)

    _

    _

    _

    _

    +

    Ram Ganga River, Barelli(G)

    _

    _

    +

    _

    _

    Ram Ganga River, Barelli(Y)

    _

    _

    _

    +

    +

    TABLE VIII. SHOWING AMPLIFIED SAMPLES BY MULTIPLEX PCR

    VP: Vibrio parahaemolyticus; VV: Vibriovulnificius; VM:Vibriomimicus; VC: Vibrio cholera; VA: Vibrio alginolyticus;+ indicates the presence of species; indicates the absence of species in the sample.(g) represents green Vibrio colonies; (y) represent yellow colonies.

  3. REFERENCES

    1. Apun, K., Asiah, M. Y. and Jugang, K. 1999.Distribution of bacteria in tropical freshwater fish and ponds. International Journal of Environmental Health Research 9: 285-292.

    2. Ashbolt N. J. Microbial contamination of drinking water and disease outcomes in developing regions .Toxicology 198 (2004) 229238 ELSEVIER.

    3. Badrie, N., Gobin, A., Dookeran, S. and Duncan, R. 2006.Consumer awareness and perception to food safety hazards in Trinidad, West Indies. Food Control 17: 370- 377.

    4. Centers for Disease Control and Prevention (CDC).COVIS Annual Summary, 2009. Atlanta, Georgia: US Department of Health and Human Services, CDC, 2011.

    5. Central Pollution Control Board [CPCB] (2008), Status of Water Supply, Waste water Generation and Treatment in Class-I Cities and Class-II Towns of India, Control of Urban Pollution Series, CUPS/70/2009-10, New Delhi.

    6. Chakraborty R., Sinha S Mukhopadhyay K, Asakura M, Yamasaki S, Bhattacharya SK, Nair GB, Ramamurthy T (2006). Species specific identification of Vibrio fluvialis by PCR targeted to the conserved transcriptional activation and variable membrane tether regions of the tox R gene. J. Med. Microbiol. Correspond. pp. 805-808.

    7. Chakraborty, R. D., Surendran, P. K. and Joseph, T. C. 2008.Isolation and characterization of Vibrio parahaemolyticus from sea foods along the southwest coast of India. Worlds Journal of Microbiology and Biotechnology 24: 2045-2054.

    8. Christopher M. A. Caipang, and Mary Paz N. Aguana(2011). Conventional PCR assays for the detection of pathogenic Vibrio spp. in shrimp aquaculture in the Philippines. AACL Bioflux, 2011, Volume 4, Issue 3.

    9. Di Pinto, A., Ciccarese, G. De Carota, R., Novello, L. and Terio, V. 2008.Detection of pathogenic Vibrio parahaemolyticusin southern Italian shellfish. Food Control 19: 1037-1041.

    10. Dixit Usha and Shanker Rishi (2006). Detection of water-borne pathogens: culture plate to genomics. Indian Journal of Science and Technology Vol.2 No. 11 (Nov. 2009).

    11. Drake SL, DePaola A, Jaykus LA (2007). An Overview of Vibrio vulnificus and Vibrio parahaemolyticus. Compr. Rev. Food Sci. Food Saf., 6: 120-144.

    12. Edwards, MC.,& Gibbs, RA. (1994). Multiplex PCR: advantages, development and applications. Genome Res. 3, pp. (S65- S75).

    13. Edwards, MC.,& Gibbs, RA. (1994). Multiplex PCR: advantages, development and applications. Genome Res. 3, pp. (S65- S75).

    14. Farmer JJ, Hickman-Brenner FW (1991). The Genera Vibrio and Photobacterium In: Ballows et al., (eds) The Prokaryotes (2ndedn.) SpringerVerlag, New York, pp. 2952-3011.

    15. Farmer JJ, Janda JM, Brenner FW, Cameron DN, Birkhead KM (2004). In: Garrity et al., (eds.) Bergys Manual of Systematic Bacteriology (2nd edn) Springe-Verlag, New York, pp. 494-545.

    16. Gopal, S., Otta, S. K., Karunasagar, I., Nishibuchi, M. and Karunasagar, I.2005.The occurrence of Vibrio species in tropical shrimp culture environments; implications for food safety. International of Food Microbiology 102: 151-159.

    17. Haldar S., Neogi S. B., Kogure K., Chatterjee S., Chowdhury N., Hinenoya A., Asakura M., Yamasaki S., (2010).Development of a haemolysin gene-based multiplex PCR for simultaneous detection of Vibrio campbellii, Vibrio harveyi and Vibrio parahaemolyticus. Lett Appl Microbiol 50:146-152.

    18. Harwood, VJ. Gandhi, JP. & Wright, AC. (2004). Methods for isolation and confirmation of Vibrio vulnificus from oysters and environmental sources: a review. J. Microbiol. Methods, 59, pp. (301-316).

    19. Henegariu O, Heerema NA, Dlouhy SR, Vance GH, Vogt PH (1997). Multiplex PCR: critical parameters and step-by-step protocol. Biotech 1997; 23(3):505-11.

    20. Hsueh PR, Lin CY, Tang HJ, Lee HC, Liu JW, Liu YC, Chuang YC (2004). Vibrio vulnificusin Taiwan.Emerg. Infect. Dis., 10: 1363-1368.

    21. Jacxsens, L., Kasuga, J., Luning, P. A.,Van der Spiegel, M., Devlieghere, F. And Uyttendaele, M. 2009. A microbial assessment scheme to measure microbial performance of food safety management systems. International Journal of Food Microbiology 134: 113-125.

    22. Kaysner CA, Tamplin ML, Twedt RM (1992).VibrioIn: Vanderzant C, Splittstoesser DF (eds) Compendium of methods for the microbiological examination of foods (3rdedn) APHA, Washington D.C., pp. 451-447.

    23. Kaysner, C. and De Paola, A. J. 2004.U.S. Food and Drug Administration; Bacteriological Analytical Manual; Methods for specific pathogens; Chapter 9 Vibrio. Available http://www.fda.gov/Food/scienceResearch/LaboratoryMethods/Bacteri ological.Analytical Manual BAM/ucm070830.htm.Accessed on 15 April 2010.

    24. Kindhauser, M.K., 2003.Global defense against the infectious disease threat. Communicable Diseases 2002. World Health Organization, Geneva.

    25. Kinge Wose C.N., Mbewe M. and Sithebe N. P.(2012). Detection of Bacterial Pathogens in River Water Using Multiplex-PCR, Polymerase Chain Reaction, Dr Patricia Hernandez-Rodriguez (Ed.), ISBN: 978- 953-51-0612-8, InTech.

    26. Luan, X., Chen, J., Liu, Y., Li, Y., Jia, J., Liu, R. and Zhang, X. H. 2008.Rapid quantitative detection of Vibrio parahaemolyticusin seafood by MPN-PCR. Current Microbiology 57: 218-221.

    27. Meays, C., Broersma, K., Nordin, R., &Mazumder, A. (2004). Source tracking faecal bacteria critical review of current methods. J. Environ. Man. 73, pp. (71-79).

    28. Montanari MP, Pruzzo C, Pane L, Colwell RR (1999).Vibrios associated with plankton in a coastal zone of the Adriatic Sea (Italy). FEMS Microbiol. Ecol., 29: 241-147.

    29. Noorlis, A.,Ghazali, F. M., Cheah, Y. K.,Tuan Zainazor, T. C., Ponniah, J., Tunung, R., Tang, J. Y. H., Nishibuchi, M., Nakaguchi, Y. and Son, R. (2011). Prevalence and quantification of Vibrio species and Vibrio parahaemolyticus in freshwater fish at hypermarket level. International Food Research Journal 18: 689-695.

    30. Novotny L. Dvorska L, Lorencova A, Beran V PavlikI(2004). Fish: A potential source of bacterial pathogens for human beings. Vet-Med. Check, 49: 343-358.

    31. Oliver, J.D., Kaper, J.B. (1997).Vibrio species. In: Doyle, M.P., Beuchat, L.R., and Montville, T.J (Eds) Food Microbiology- Fundamentals and Frontiers.ASM Press. Washington D.C., p. 228-264.

    32. Opinion of TheScintific on Veterinary measures relating to public health on Vibrio vulificus and Vibrio parahaemolyticus(in raw and undercooked seafood) (2001) European Commission Health and Cosumer protection Directorate General.

    33. Performance Audit of Water Pollution in India (2011-12) Ministry of Environment and Forests Comptroller and Auditor General of India Report No. 21 of 2011-12.

    34. Rodkhum C., Hirono I., Crosa J. H., Aoki T., 2006 Multiplex PCR for simultaneous detection of five virulence hemolysin genes in Vibrio anguillarum. J Microbiol Methods 65:612-618.

    35. Shikongo-Nambabi M. N. N. N., Petrus N. P and Schneider M. B.(2012).Review The role, isolation and identification of Vibrio species on the quality and safety of seafood. Biotechnology and Molecular Biology Review Vol. 7 (2), pp. 16-30, June 2012.Available online at http://www.academicjournals.org/BMBR.

    36. Shikongo-Nambabi MNNN; Chimwamurombe PM, Venter SN (2010). Molecular and Phenotypic Identification of Vibro Spp. Isolated from Processed Marine Fish. Proceedings of the National Research Symposium 15-17 September Safari Hotel Windhoek, Namibia (in print).

    37. Surender Kumar and M N. Murty. "Water Pollution in India: An Economic Appraisal" India Infrastructure Report 2011: Water: Policy and Performance for Sustainable Development. IDFC and Oxford University Press, 2011.

    38. Thompson FL, Gevers D, Thompson CC, Dawyndt P, Naser S, Hoste B, Munn CB, Swings J (2005). Phylogeny and Molecular Identification of Vibrioson the Basis of Multilocus Sequence Analysis. Appl. Environ. Microbial, 71: 5107-5115.

    39. Thompson FL, Gomez-Gil B, Vasconcellos ATR and Sawabe T (2007).Multilocus Sequence Analysis Reveals that Vibrioharveyi and

  4. campbellii Are Distinct Species. Appl. Environ. Microbiol., 73: 4279- 4285.

  1. Thompson FL, Iida T and Swings J (2004). Biodiversity of Vibrios. Microbiol. Mol. Biol. Rev., 68: 403-431.

  2. Thompson FL, Iida T and Swings J (2004). Biodiversity of Vibrios. Microbiol. Mol. Biol. Rev., 68: 403-431.

  3. UK Standards for Microbiology Investigations: Identification of Vibrio species. Issued by the Standards Unit, Microbiology Services Division, HPA. Bacteriology – Identification | ID 19 | Issue no: 2.1| Issue date: 21.10.11| Page: 1 of 13.

  4. UNDPI. (2005). The International Decade for Action: Water for Life 2005-2015. United Nations Department of Public Information.

  5. Vengadesh, L., Son, R. and, Yoke-Kqueen, C. (2012).Molecular quantization and characterization of Vibrio cholerae from different seafood obtained from wet market and supermarket. International Food Research Journal 19(1): 45-50 (2012).

  6. Vongxay, K., Wang, S., Zhang, X., Wu, B., Hu, H., Pan, Z., Chen, S. and Fang, W. 2008. Pathogenetic characterization of Vibrio parahaermolyticus isolates from clinical and seafood sources. International Journal of Food Microbiology 126: 71-75.

  7. West, P.A. (1989). The human pathogenic Vibrios – A public health update with environmental perspectives. Epidem 103: 1-34.

  8. WHO. (2001). Guidelines for Drinking-Water Quality, 2nd Ed. Microbiological Methods, vol.1. World Health Organization, Geneva.

  9. WHO. (2003). Emerging Issues in Water and Infectious Disease. Geneva, Switzerland: WHO Press, World Health Organization.

  10. WHO. (2004). Evaluation of the costs and benefits of water and sanitation improvements at the global level. WHO/SDE/WSH/04.04, Geneva.

  11. World Health Organization [WHO] (2007), Guidelines for drinking- water quality, Incorporation First Addendum, Volume 1, Recommendations, Third edition, WHO, Geneva.

  12. Yang, Z., Jiao, X., Zhou, X., Cao, G., Fang, W. and Gu, R. 2008. Isolation and molecular characterization of Vibrio parahaemolyticus from fresh, low-temperature preserved, dried and salted seafood products in two coastal areas of eastern China. International of Food Microbiology 125: 279-285.

Leave a Reply