🔒
Global Engineering Publisher
Serving Researchers Since 2012

A Survey on Breast Cancer Cell, Ovarian Cancer Profiling of Cancer Identification and Solving Technologies in The World

DOI : 10.5281/zenodo.18309345

Download Full-Text PDF Cite this Publication

Text Only Version

A Survey on Breast Cancer Cell, Ovarian Cancer Profiling of Cancer Identification and Solving Technologies in The World

Harsh N. Marvaniya1 and Urvashi Solanki2 Computer Science Engineering [ AI & ML]

shree Dhanvantary College of Engineering & Technology, Surat, India

Abstract. The purpose of this study is to determine whether a novel method can significantly enhance the quantification of various cancer cell types. A molecular diagnostic tool for identifying circulating breast cancer cells in the blood for cancer staging was to be developed as part of the real-time Reverse Transcription Polymerase Chain Reaction [RT-PCR] & Novel Porous Barrier Density Gradient Centrifugation Technology project. Evidence-based medicine states that targeted therapy trials are typically biomarker driven, more concentrated, and only treat those patients who have the underlying molecular abnormalities. A higher rate of response is achieved because the medication addresses this molecular abnormality. These findings will have significant effects on ovarian cancer screening, diagnosis, and treatment in the future. These findings will carry important implications for screening, detection, and treatment of ovarian cancer in the future.

Keywords: Ovarian cancer, Ovarian cancer types, Ovarian cancer treatments, Ovarian cancer symptoms, Ovarian cancer detection, Ovarian cancer stages.

1 INTRODUCTON

In women, there are two fallopian tubes on either side of the long, thin tubes that make up the fallopian tubes. The fallopian tubes carry eggs from the ovaries to the uterus. The peritoneum is the tissue covering the abdominal organs. Treatment is most effective when ovarian cancer is detected in its early stages. It's crucial to pay attention to your body and understand what's typical for you because ovarian cancer usually manifests as signs and symptoms. The only method to determine whether your symptoms are being caused by something other than cancer is to visit your doctor, nurse, or other healthcare provider. Certain mutations increase your risk of developing ovarian cancer. There are several distinct forms of ovarian malignancies. High-grade serous melanoma is the most prevalent excrescence type and accounts for roughly 70% of instances of ovarian cancer. The phrase "ovarian cancer" refers to a wide range of various cancers that affect the ovaries, fallopian tubes, and primary peritoneal depression rather than a one specific form of cancer. It is believed that there are more than 30 distinct forms of ovarian cancer, with a vast variety in prevalence and prognosis among the various types. Ovarian cancer is the most lethal of the female malignancies for which there is no reliable screening diagnostic, and everyone born female is at risk. Because of the absence of webbing and the fact that symptoms are commonly mistaken with other, less serious illnesses, most patients are detected after the disease has progressed, making it more difficult to cure. While every woman is at risk, ovarian cancer is underfunded and understudied. Cancer develops when cells in the body begin to proliferate uncontrollably.

2 Ovarian Cancer

Cancer is a disease that causes a fraction of the body's cells to multiply uncontrolled and spread to neighbouring tissue. Ovarian cancers are a type of sickness that affects the ovaries. Despite the fact that they are all ovaries-related illnesses, they differ in their genesis, appearance under a microscope, treatment choices, and prognosis. Ovarian tumours can be either malignant or benign (cancerous). Despite their abnormality, benign tumour cells do not spread (spread to other parts of the body). The majority of ovarian cancer patients are diagnosed after the disease has progressed, and just 28% survive five years [1][15].

3 Common Symptoms of Ovarian Cancer

There are symptoms associated with ovarian cancer, but they are frequently quite mild and can be confused for other, more typical issues. Early-stage ovarian malignancies may occasionally create symptoms, but most often, they don't appear until the cancer has progressed (when the growth of the tumour triggers symptoms). According to several research, ovarian cancer can cause the following symptoms:

  • Bloating

  • Difficulty eating or feeling full quickly

  • Urinary symptoms (urgency or frequency)

4 OVARAN CANCER DETECTON

Early Detection of Ovarian Cancer No reliable screening or early detection tests exist for ovarian cancer. The Pap test does not test for ovarian cancer; it screens for cervical.

Fig. 1. Ovarian cancer detection Fig. 2. Ovarian cancer detection

A woman who displays the signs and symptoms of ovarian cancer is likely to have a comprehensive pelvic exam, a transvaginal or pelvic ultrasound, radiological tests, such as a transvaginal ultrasound or CT scan, and a CA-125 blood test. The OVCA3, OVCA420, OVCA429, OVCA432, OVCA433, CAOV3, DOV13, ALST, and SKOV3 ovarian cancer cell lines were utilised [2][16]. The HOSE17, HOSE636, HOSE642, HOSE697, HOSE713, HOSE726, and HOSE730 standard HOSE cells were utilised. As indicated before, solid tumours were removed or ascites fluid was recovered to establish ovarian cancer cell lines [3][17]. See Figure. 1, Fig. 2

5 REAL-TME QUANTTATVE REVERSE TRANSCRPTON POLYMERASE REACTON

RT-PCR was performed in duplicate using an ABI PRISM 5700 Sequence Detector (PE Applied Biosystems, Foster City, CA) and primer sets specific for the overexpressed gene encoding the secretory protein known as prostasin (forward primer "5'- ACTTGAGCCACTCCTTCCTTCAG3"; reverse primer "5'CTGATGGTCCCAAAAAGCACAC-3") and a housekeeping gene, GADPH[3][ RNA was first extracted from 10 ovarian cancer cell lines (OVCA3, OVCA420, OVCA429, OVCA432, OVCA433, CAOV3, DOV13, SKOV3, and ALST) as well as normal ovarian epithelial cell cultures (HOSE697, HOSE713, HOSE726, and HOSE730) [4][12]. cDNA was produced using the TaqMan RT reagents included from 1 ug of total RNA. 1: Multicurie reverse transcriptase (PE Applied Biosystems) at 1.25 U/uL, TaqMan reverse transcriptase buffer, 5.5 mM MgCl2, all four deoxyribonu- cleoside triphosphates (each at 500 uM), and RNasin (Promega Corp) [5][18]. At 0.4 U/uL in 100 uL, Madison, WI. The reaction was then heated to 95 °C for 5 minutes after being incubated at 25 °C for 10 minutes, 48 °C for 30 minutes, and lastly. A 20 -uL PCR combination comprising 1 SYBR® PCR buffer, 3 mM MgCl2, all four deoxyribonucleoside triphosphates (each at 0.8 mM), and Aplite Gold (all from PE Applied Biosystems) was employed to analyse a total of 1 ug of cDNA [6][19].

Early Detection of Ovarian Cancer There are no reliable screening or early detection methods for ovarian cancer. The Pap test does not screen for ovarian cancer; it only looks for cervical cancer.

A woman who displays the signs and symptoms of ovarian cancer is likely to have a comprehensive pelvic exam, a transvaginal or pelvic ultrasound, radiological tests, such as a transvaginal ultrasound or CT scan, and a CA-125 blood test. When used inde- pendently, these tests are not conclusive; instead, they perform best when used in conjunction with one another. Some of these tests may be used by doctors to determine whether a patient has a serious family history or genetic risk, such as a BRCA mutation..

6 BLOOD TESTS

6.1 CA-125

Even though the CA-125 blood test is more accurate in postmenopausal women, it is not a viable early detection screening for ovarian cancer. In around 20% of patients with advanced-stage ovarian cancer and 50% f cases with early-stage ovarian cancer,

the CA-125 is not elevated even when ovarian cancer is present. As a result, croakers frequently do both a CA-125 blood test and a transvaginal ultrasound. Since CA-125 misses 50% of early tumours and might be inflated by benign conditions, the National Cancer OVA- 1 has also received FDA clearance for danger position. When a woman has a known tumour, this test may be used to determine whether she should have her surgery done by a gynaecologist or a gynecologic surgeon who has had extensive training in treating patients with gynecologic malignancies [7][20]. The test measures five blood proteins that change when ovarian cancer is present. There is, however, no proof that this test can be used to screen for ovarian cancer, that it may aid in early identification, or that it can lower the risk of mortality from this illness.

    1. Inhibin B and Inhibin A

      Granulosa cell tumours are most often detected and/or monitored via the following blood indicators: Inhibin B and Inhibin A.

    2. Transvaginal Ultrasound

      A transvaginal ultrasound is a procedure used to examine a woman's bladder and reproductive system. It may commonly reveal the presence of tumours or other irregularities both inside and outside of ovarian cysts. To perform the test, the doctor inserts a probe into the vagina. The probe sends out sound waves, which are reflected back to it by the body. The waves are then captured by a computer, which creates a picture. With just an ultrasound, ovarian cancer cannot be adequately screened.

    3. Pelvic Exam

      A pelvic examination might be done as part of a standard gynecologic health assessment. During this examination, the doctor must place one or two fingers into the patient's vagina and another over her belly in order to feel the size, shape, and placement of the ovaries and uterus. Ovarian cancer is seldom discovered with a pelvic exam, and when it is, it is frequently at an advanced stage.

    4. Recto-vaginal Pelvic Examination

      During this treatment, your doctor may examine your ovaries to look for tumours or other changes in size or form. Every woman should have a rectal and vaginal pelvic examination conducted at her yearly gynaecological visit. A Pap test is part of a routine pelvic exam, however it only tests for cervical cancer and not ovarian cancer.

    5. Diagnosis

Only surgery & biopsy are effective ways to diagnose ovarian cancer in a patient. Only after obtaining adequate information from their examination and test results would physicians do surgery. If there is a suspicion of ovarian cancer as a consequence of these tests, the patient should request a re-referral to a gynaecologic oncologist before having surgery. According to study, those who have gynaecologic cancer tend to live longer than those who have other cancers. In order to do a biopsy, remove a tiny benign cyst or an early stage of ovarian cancer, and assess the progression of the disease, a doctor may also undertake laparoscopic surgery. Using a laparoscope, a small tube with a camera, a doctor may view within the patient's abdomen and remove tissue.

Fig. 3. Complication from Treatment Fig. 4. Complication from Treatment

Fig. 5. Complication from Treatment

7 OVARAN CANCER STAGED

A technique to describe the extent of your cancer's spread is through staging. When your doctor stages your cancer, a number of things are taken into account, such as:

  • Which organs are affected by the malignant cells? Your doctor will want to know if the cancer has progressed to other surrounding organs in the pelvis, abdomen, or anywhere else. It may be in one or both of the ovaries.

  • There are several methods for cancerous cells to spread throughout your body. Ovarian cancer can spread through blood arteries, lymph nodes, and the pelvis and abdomen directly.

    Ovarian cancer progresses through four phases. The lowest number is the least severe. The number rises the more serious the problem. Staging is crucial because it will enable your doctor to create a personalised treatment strategy for you. With you, your healthcare practitioner will go through this strategy and the finest forms of therapy. Staging is crucial because it will enable your doctor to create a personalised treatment strategy for you. With you, your healthcare practitioner will go through this strategy and the finest forms of therapy.

    Table 1. Parameter of ovarian cancer

    Method

    Data partition

    Required Trusted Sever

    Type

    Strategy Used

    Numerical Data Applicable

    Categorical Data Applicable

    CT-SCANE [7]

    Distributed

    Yes

    Diagnosis

    ML & DS

    No

    Yes

    CA-125 [8]

    Distributed

    No

    Blood Test

    DS

    Yes

    No

    Computerised Tomography [9]

    Encrypted

    No

    Diagnosis

    ML & DS

    Yes

    No

    OVA-1 [10]

    Encrypted

    No

    Blood Test

    AI

    Yes

    No

    Biopsy [11]

    Encrypted

    Yes

    Diagnosis

    Treatment

    No

    Yes

    Inhibin A & Inhibin B [12]

    Yes

    Blood Test

    ML

    No

    Yes

    Pelvic Exam [13]

    Yes

    Blood Test

    Encrypted

    Yes

    Yes

    Surgery [14]

    Encrypted

    Yes

    Diagnosis

    Treatment

    Yes

    Yes

    1. Conclusion

      There is still much to learn about ovarian tumours, especially in regards to the origins and mechanisms connected to development, despite the fact that the disease has been the focus of substantial study in recent years. Knowing how to properly apply our growing understanding of the molecular anomalies linked to ovarian cancer will be crucial to improving clinical outcomes. Anti-angiogenic medicines and PARP inhibitors have been identified as the most promising options thus far among the several targeted therapies now being studied in phase I/II and III research. Targeted treatment is hindered by the selection of the appropriate population to treat as well as a lack of knowledge about the processes driving drug resistance.

      REFERENCE

      1. Prostasin, a Potential Serum Marker for Ovarian Cancer, Journal of the National Cancer Institute, Vol.9, No.19, October 3, 2001.

      2. Molecular Detection of Breast Cancer Cells in the Peripheral Blood of Advanced-Stage Breast Cancer Patients Using Multimarket Real-Time Reverse Transcription-Polymerase Chain Reaction, in Clinical Cancer Research 4865, Vol. 9, 4865 4871, October 15, 2003

      3. Transcriptional complementarity in breast cancer: application to detection of circulating tumor cells. Mol. Dian., 6: 7991, 2001.

      4. A cell surface serine protease identified in hepatoma cells, is overexpressed in ovarian cancer. Journal of the National Cancer Institute; 57:28847, Cancer Res 1997.

      5. Orviain cancer, Anu Rev Pathos. 2009; 4: 287313, 2010 Jan 1.

      6. Serum creatine kinase BB isoenzyme as a diagnostic aid in occult small cell lung cancer.in clinical cancer research; 56:562 6 1985.

      7. Overexpression of testing, a serine protease expressed by testicular germ cells;7:35862, 2000.

      8. SEER cancer statistics review. Betesda (MD): National Cancer Institute; 1998.

      9. Response of circulating tumour cells to systemic therapy in patients with metastatic breast cancer: J. Clin. Oncol., 18: 14321439, 2000

      10. Molecular detection of telomerase-positive circulating epithelial cells in metastatic breast cancer patients. Clin. Cancer Res., 5: 971975, 1999.

      11. Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer. Int. J. Cancer, 78: 661666, 1998.

      12. Detection of circulating mammary carcinoma cells in the peripheral blood of breast cancer. J. Clin. Oncol., 17: 20152019, 2021.

      13. Sensitive detection of micro metastases in bone marrow from patients with breast cancer using immunomagnetic isolation of tumour cells in combination with reverse transcriptase/polymerase chain reaction for cytokeratin-19. J. Cancer Res. Clin. Oncol., 126: 212218, 2020.

      14. Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques, 32: 13721374, 1376, 1378 1379, 2002.

      15. Carcinoembryonic antigen: an invaluable marker for advanced breast cancer. J. Postgrad. Med., 42: 6871, 1996.

      16. Carcinoembryonic antigen: an invaluable marker for advanced breast cancer. J. Postgrad. Med., 42: 6871, 1996.

      17. Characterization of human ovarian surface epithelial cells immortalized by human papilloma viral oncogenes (HPV-E6E7 ORFs). Exp Cell Research; 218:499507,2021.

      18. A radioimmunoassay using a monoclonal antibody to monitor the course of epithelial ovarian cancer. N England J Medicines

        & researches; 309:8837,2020.

      19. Prostasin is a novel human serine proteinase from seminal fluid,Purification, tissue distribution, and localization in prostate gland. J. Biological Chemistry; 269:188438,2020.

      20. Identification of differentially expressed genes from ovarian cancer cells by MICROMAX Cdna microarray system. Biotech- niques; 30:6705,2021.